readme.txt 5.1 KB
Newer Older
Thomas Van Parys's avatar
Thomas Van Parys committed
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212

                  TAPIR, target prediction for plant microRNAs

                  (c) 2010 Eric Bonnet eric.d.bonnet@gmail.com

                                  Version 1.2

                                   ---oOOo---



 --[ Citation

 If you're using this program, please cite our paper:

  TAPIR, a web server for the prediction of plant microRNA targets, including
  target mimics.
  
  Eric Bonnet, Ying He, Kenny Billiau and Yves Van de Peer
  
  http://bioinformatics.oxfordjournals.org/content/26/12/1566.abstract



 --[ License

   This standalone version for Linux machines is free software, released under
   the terms of the GNU GPL license. See the LICENSE file for details.



 --[ Fee

   The usage of this program is free of charge for academics and nonprofit
   organizations. 
   
   For any commercial usage, please contact the authors.



 --[ Installation

     This distribution is for Linux based machines only.

     REQUIRED: The following perl module and libraries must be installed:

     - Bioperl (www.bioperl.org) 
     - ViennaRNA library + perl modules (www.tbi.univie.ac.at/RNA/)

     Unpack the tape archive file in a suitable directory, e.g. /usr/local/

       tar xzvf tapir-1.1.tar.gz

     Include the directory in your PATH

       export PATH="${PATH}:/usr/local/tapir-1.1/"

     You're now ready to go!




 --[ Search with the FASTA engine (fast search)

    Usage tapir_fasta [options]
    --mir_file mir fasta file
    --target_file target fasta file
    --score <value> score cutoff
    --mfe <value> mfe ratio cutoff

    Example:
    tapir_fasta --mir_file 163.fa --target_file AT1G66720.fa 
    tapir_fasta --score 2 --mfe_ratio 0.6 --mir_file 163.fa --target_file AT1G66720.fa




 --[ Search with the RNAhybrid engine (precise search)

   The search is done in two steps. First running the RNAhybrid program and
   second parse the raw results. The two steps can be combined by creating a
   pipe, or done separately. The reason for having two steps is that the
   RNAhybrid search is quite slow. This step can be parallelized on a cluster,
   using the first command.

   * RNAhybrid raw results

   Usage: tapir_hybrid <mir_file> <target_file>

   * Parsing the results

   Usage hybrid_parser [options]
   --mimic <1> search for target mimics (default 0)
   --score <value> score cutoff (default 4)
   --mfe <value> mfe ratio cutoff (default 0.7)

   The option mimic toggles the search for target mimics. The only possible
   option is to play with the mfe_ratio value.

   Example:
   tapir_hybrid 399a.fa IPS1.fa | hybrid_parser --mimic 1 
   tapir_hybrid 399a.fa IPS1.fa | hybrid_parser --mimic 1 --mfe_ratio 0.6

   If the option mimic is not enabled, then the program is looking for
   microRNA targets, like the tapir_fasta program.

   Example:
   tapir_hybrid 163.fa AT1G66720.fa | hybrid_parser
   tapir_hybrid 163.fa AT1G66720.fa | hybrid_parser --score 2 --mfe_ratio 0.6




  --[ Output examples


> tapir_fasta --mir_file 163.fa --target_file AT1G66720.fa 

# Search options
# miRNA file 163.fa
# target file AT1G66720.fa
# score <= 3.5
# mfe ratio >= 0.7
#
miRNA         ath-miR163
target        AT1G66720.1
score         2
mfe_ratio     0.91
start         333
seed_gap      0
seed_mismatch 0
seed_gu       1
gap           1
mismatch      0
gu            0
miRNA_3'      UAGCUUCAAGGUUCAGGAGAAGUU
aln           ||||.|||||||o|||||||||||
target_5'     AUCG-AGUUCCAGGUCCUCUUCAA
//


> tapir_hybrid 163.fa AT1G66720.fa | hybrid_parser 

# Search options
# mimic = 0
# score <= 4
# mfe_ratio >= 0.7
#
miRNA          ath-miR163
target         AT1G66720.1
score          2
mfe            -41.8
mfe_ratio      0.8970
start          332
gap            1
mismatch       0
GU             0
seed_gap       0
seed_mismatch  0
seed_GU        1
miRNA_3'       UAGCUUCAAGGUUCAGGAGAAGUU
aln            ||||.|||||||o|||||||||||
target_5'      AUCG-AGUUCCAGGUCCUCUUCAA
//

> tapir_hybrid 399a.fa IPS1.fa | hybrid_parser --mimic 1

# Search options
# mimic = 1
# mfe_ratio >= 0.7
#
miRNA     ath-miR399a
target    IPS1-AT3G09922.1
mfe       -31.9
mfe ratio 0.7401
start     237
gap       4
mismatch  2
GU        1
miRNA_3'  GUCCCGUUUAG---AGGAAACCGU
aln       ..||||||.|o...||||||||||
target_5' -UGGGCAACUUCUAUCCUUUGGCA
//




 --[ Compilation of the fasta and trh programs


 TAPIR is using the FASTA software of Bill Pearson for the fast search option
 (see http://faculty.virginia.edu/wrpearson/fasta/).

 A pre-compiled binary for Linux is provided, but the source code is available
 in the directory src_fasta/. To compile it, just go in that directory and type
 the command 'make', after a while and if everything goes well, the binary
 fasta34 should be available.

 TAPIR is using the software RNAhybrid developped by Marc Rehmsmeier for the
 sensitive search option (see
 http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/).

 I made very small modifications of the source code to get extra output
 parameters, such as the free energy ratio of the duplex. The modified source
 code is available in the directory src_trh/. To compile it, just go in that
 directory and type 'make'. The binary program 'trh' should be ready after the
 compilation.




[[EOF]]